Extractions: Expression and accumulation of lysyl oxidase elastin , and type I procollagen in human Menkes and mottled mouse fibroblasts Menkes syndrome in humans is an X-linked disorder characterized in part by abnormal copper transport, cellular copper sequestration, and defective crosslinking of collagen and elastin
Assay ID Gene Symbol Gene Symbol Alias Allele Nomenclature Cu++ transporting, alpha polypeptide (menkes syndrome) NM_000052TGCCTACTCTTTGATTATTCTTCTAC/GTTGCAATGTATGAGAGAGCCAAAGT 77509586 Celera human R27 Xq13 http://myscience.appliedbiosystems.com/genotyping/dme_index.txt
Enter Here Learn about menkes Kinky Hair syndrome through the experiences of Justin Gordonand Family Taken March 6, 2002. Justin passed away March 3, http://www.menkessyndrome.com/
Friends Of Alexander Deihl A nonprofit organization established to help children and their families who have been affected by a crippling disorder or are terminally ill. About menkes' syndrome with support. http://www.geocities.com/Heartland/Grove/1590/index.html
Extractions: This year is special, Alex is now a teenager. The key to Alex's well being is the vigilant care and the extraordinary love that is given to Alex by his medical staff, teachers, friends, family and most especially his parents. Although in his thirteen years Alex has experienced more setbacks than he would care to remember, he remains the sweet earthly angel that was sent to us to teach us all the true meaning of love. By supporting the Friends of Alexander Deihl your care and concern is lovingly demonstrated. With your contributions, we continue to purchase equipment such as ramps, wheelchair accessories, computers and adaptive bicycles to name a few. You have assisted children and their families with the prohibitive costs of prolonged hospital stays. Your help has lightened the burden of grieving families. On behalf of all of them we offer our deepest gratitude.
Menkes’ Disease, Menkes' Syndrome menkes disease is a rare hereditary disorder caused by a deficiency of copper.1 Untilrecently, menkes disease was considered universally fatal.2 However, http://www.truestarhealth.com/Notes/1237000.html
Extractions: Welcome to the Truestar Health Encyclopedia Welcome to the Truestar Health Encyclopedia the most comprehensive information database available on health, wellness, food, nutrition, vitamins and supplements. Use of our encyclopedia will enable you to make well-informed, responsible decisions for the promotion of your own health and wellness. Enter search items Also indexed as: Menkes' Syndrome copper However, it now appears that the severity of the disease varies from person to person. Medical doctors often use genetic analysis to diagnose this disorder, even before birth. In cases where the genetic defect appears responsive to copper therapy, early treatment is needed to minimize the severity of the physical defects that will develop later. Rating Nutritional Supplements Herbs Copper (injectable) Reliable and relatively consistent scientific data showing a substantial health benefit.
Extractions: Vol. 123 No. 10, October 1987 Featured Link E-mail Alerts ARTICLE Article Options Send to a Friend Readers Reply Submit a reply Similar articles in this journal Literature Track Add to File Drawer Download to Citation Manager PubMed citation Articles in PubMed by Hamer DH Contact me when this article is cited D. H. Hamer Laboratory of Biochemistry, National Cancer Institute, Bethesda, Md 20892. The characteristic feature of Menkes' disease is a maldistribution of bodily copper; decreased copper levels are present in the serum, brain, and liver, whereas excess levels are present in gut, kidney, and most other nonhepatic tissues. Using cultured fibroblasts, we have shown that low extracellular copper concentrations induce synthesis of metallothionein, a copper-binding protein, in Menkes' cells but not in normal cells. This is
Extractions: This Article Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Alert me to new issues of the journal Download to citation manager PubMed Articles by Garnica, A. Articles by Rennert, O. Annals of Clinical and Laboratory Science, Vol 8, Issue 4, 302-309 AD Garnica, WY Chan, and OM Rennert Fibroblasts from infants with Menkes kinky hair syndrome, which accumulate excessive quantities of copper, are thought to represent a disorder of copper storage or transport. Because of this abnormality, it was thought that they might provide a useful system for investigation of the presumed storage or transport protein metallothionein. Data are presented which are consistent with defective copper efflux from the mutant cells. Because of the more specific role of metallothionein in cadmium detoxification, studies of cadmium metabolism were undertaken which demonstrated abnormal cadmium retention and metallothionein induction in the mutant cells. The association, therefore, of a defect of cadmium metabolism and storage with an abnormality of copper efflux provides evidence implicating metallothionein in copper transport for fibroblasts.
Menkes Kinky-hair Syndrome a CHORUS notecard document about menkes kinkyhair syndrome. http://chorus.rad.mcw.edu/doc/00262.html
Menkes Kinky-hair Syndrome menkes kinkyhair syndrome. defective intestinal copper absorption. X-linkedrecessive; males only; presents in early infancy. Wormian bones http://chorus.rad.mcw.edu/to-go/00262.html
RedNova News - Health - CLINICAL REVIEW: Disorders Of Copper Metabolism menkes syndrome is an inherited Xlinked copper deficiency disease. * Wilson sdisease results in excess copper in the liver, brain, and elsewhere. http://www.rednova.com/news/health/148409/clinical_review_disorders_of_copper_me
Extractions: ANDP("ntn"); Ads_kid=0;Ads_bid=0;Ads_xl=0;Ads_yl=0;Ads_xp='';Ads_yp='';Ads_xp1='';Ads_yp1='';Ads_opt=0;Ads_wrd='[KeyWord]';Ads_prf='';Ads_par='';Ads_cnturl='';Ads_sec=0;Ads_channels=''; Return to Flight Space Science Technology Health ... Video News RedNova E-Mail My RedNova Join RedNova RSS Feeds ... Tell A Friend, Win $500 Ads by Google Posted on: Friday, 6 May 2005, 03:00 CDT E-mail this to a friend Printable version Discuss this story in the forum Change Font Size: A A A The essentials * Copper is an essential component of many enzymes. * Absorption of dietary copper mainly takes place in the small intestine. * Menkes' syndrome is an inherited X-linked copper deficiency disease. * Wilson's disease results in excess copper in the liver, brain, and elsewhere. * The Institute of Food Research is studying copper regulation and absorption. 1. The need for dietary copper The fact that copper is an essential element in the human diet is now well-established, but this has not always been the case. In the early 19th century the finding of copper in plant and animal tissues was thought to be due to contamination, either from the environment or in the sampling process. It wasn't until 1928 that the pioneering work of Hart and his colleagues demonstrated that both copper and iron were necessary for haemoglobin synthesis and the prevention of anaemia. An essential component Since then copper has been identified as an essential component of many enzymes, including those involved in antioxidant defence, connective tissue formation and neurological function. Despite its essential nature, copper levels need to be tightly regulated to avoid cellular excess and prevent its participation in reactions that produce oxygen-free radicals.This is important because free radical damage is thought to contribute to the development of cancer and cardiovascular disease.
Menkes, Syndrome De Translate this page Base de données sur les maladies rares et les médicaments orphelins. http://www.orpha.net/static/FR/menkes.html
Extractions: HOME HELP FEEDBACK SUBSCRIPTIONS ... TABLE OF CONTENTS This Article Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager ... Cited by other online articles PubMed PubMed Citation Articles by Tobias, J. D. JD Tobias Division of Pediatric Anesthesiology/Critical Care Medicine, Vanderbilt University, Nashville, Tennessee. The author presents and discusses the anaesthetic implications of a four-month-old infant with Menkes' syndrome who required tracheostomy. Menkes' syndrome is an X-linked recessive disorder of copper absorption and metabolism. Defective processing of copper results in abnormalities of several enzyme systems leading to severe dysfunction of multiple organ systems. Due to the progressive nature of this disorder and its severe effects on several different organ systems, most importantly the central
Extractions: Link to Blogcritics! var site="s11blogcritics" Home Posted by bookofjoe on December 27, 2003 02:52 PM (See all posts by bookofjoe Filed under: Books Scroll down to read comments on this story and/or add one of your own. The Angry Puppet Syndrome John H. Menkes Book from Demos Medical Publishing Release date: 01 September, 1999 Menkes is a pediatric neurologist at UCLA, famous for his discovery of Maple Syrup Urine Disease (you can guess the main sign), also known as Menkes' Disease or Menkes' Syndrome. I was in his clinic one afternoon during my peds rotation at UCLA Med School, where some kid whose disease was undiagnosable was brought in. Menkes walked into the room with all of us med students, interns, and residents behind him, looked at the kid, asked the mother a few questions, wiggled the kid's finger and wrists, said, "this is a case of so-and-so," and walked out of the room.
Extractions: This Article Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal ... Download to citation manager PubMed PubMed Citation Articles by Harcke, H. T., Jr Articles by Valdes-Dapena, M. HT Harcke Jr, MA Capitanio, WD Grover and M Valdes-Dapena Multiple unusual diverticula of the bladder were observed in 3 of 4 children with Menkes' syndrome. This abnormality of the bladder in children with the kiky hair syndrome has only recently been recognized. The diverticula are best visualized on cystographic studies. The clinical manifestation which led to roentgen evaluation of the urinary tract in the 3 children was urinary tract infection or urine retention. Though the
Extractions: Vol Page [Advanced] This Article Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Services Email this link to a friend Similar articles in ADC Online Similar articles in PubMed Alert me to new issues of the journal ... Download to citation manager PubMed PubMed Citation Articles by Daish, P Articles by Jones, R. P Daish, EM Wheeler, PF Roberts and RD Jones
Copper, Serum Or Plasma Deficiency, Nutritional, menkes syndrome, Acute Copper Toxicity, ICC and ChronicCopper Toxicity, Wilson s Disease, Smoking, Inflammatory Conditions, http://www.labcorp.com/datasets/labcorp/html/chapter/mono/bm004700.htm
Extractions: Copper, Serum or Plasma Number CPT Related Information Copper, Urine Synonyms Cu, Plasma; Cu, Serum Specimen Serum or plasma Volume 1 mL Minimum Volume 0.2 mL Container Red-stopper tube or royal blue-stopper (EDTA or heparinized plasma) tube Collection Serum must be separated from cells within 45 minutes of collection and transferred to a plastic transport tube. Plasma may be separated immediately and transferred to a plastic transport tube for shipment to the laboratory. Storage Instructions Maintain specimen at room temperature. Causes for Rejection Gel tube; unspun red-stopper tube Reference Interval Use Serum copper is low in Menkes' syndrome. Copper in the CSF is reported to mirror the neurotoxicity of copper in Wilson disease. Liver copper is used to confirm Wilson disease and Menkes' syndrome and may be measured in liver disease of uncertain etiology. It can confirm ICC in the right setting. Liver copper rises with time in biliary cirrhosis, but does not confirm the diagnosis.
