81. Expression And Accumulation Of Lysyl Oxidase, Elastin, And Type I Procollagen In menkes syndrome in humans is an Xlinked disorder characterized in part by abnormalcopper transport, cellular copper sequestration, and defective http://www.pdg.cnb.uam.es/UniPub/iHOP/gp/7780691.html

Expression and accumulation of lysyl oxidase elastin , and type I procollagen in human Menkes and mottled mouse fibroblasts Menkes syndrome in humans is an X-linked disorder characterized in part by abnormal copper transport, cellular copper sequestration, and defective crosslinking of collagen and elastin A decrease in the functional activity of lysyl oxidase , a cuproenzyme, is thought in part to be responsible for the decreased crosslinking of collagen and elastin It has also been suggested that low levels of lysyl oxidase activity may occur secondarily to disturbances in intracellular copper translocation and consequently impaired incorporation of copper into lysyl oxidase Herein, we examine the expression and accumulation of selected extracellular matrix proteins in fibroblasts from a Menkes patient, as well as fibroblasts from the tortoiseshell (MoTo/y) mouse. The MoTo mutation is an allele of the mottled Mo ) locus, which is considered to be a murine analog of the human Menkes locus.

82. Assay ID Gene Symbol Gene Symbol Alias Allele Nomenclature Cu++ transporting, alpha polypeptide (menkes syndrome) NM_000052TGCCTACTCTTTGATTATTCTTCTAC/GTTGCAATGTATGAGAGAGCCAAAGT 77509586 Celera human R27 Xq13 http://myscience.appliedbiosystems.com/genotyping/dme_index.txt

83. Enter Here Learn about menkes Kinky Hair syndrome through the experiences of Justin Gordonand Family Taken March 6, 2002. Justin passed away March 3, http://www.menkessyndrome.com/

Entrance Home Friends Pictures Important Links ... Contact Me Learn about Menkes Kinky Hair Syndrome through the experiences of Justin Gordon and Family Taken March 6, 2002. Internet Explorer 6 Now, you are finally ready to enter my site. Please take your time to see all the pictures, read all the info and visit all the links, and don't forget to sign my guestbook. Enter This Site You are visitor number since October 25, 2001 THIS PAGE LAST UPDATED ON MAY 13, 2004

84. Friends Of Alexander Deihl A nonprofit organization established to help children and their families who have been affected by a crippling disorder or are terminally ill. About menkes' syndrome with support. http://www.geocities.com/Heartland/Grove/1590/index.html

Friends Of Alexander Deihl "SAVE THIS DATE" Saturday, Octover 22, 2005 The Friends of Alexander Deihl will be hosting a Monte Carlo Night at St. John Chrysostom Hall Wallingford, PA The evening includes butlered hors d'oeuvres, a delicious stations buffet provided by Devine Occasions Catering of Morton, PA., wine, beer and the ever popular "Cosmopolitan Fountain". Music provided by "Sound Advice" of Wilmington, DE. This year we're hoping to include one or two celebrity dealers in the mix - Matt O'Donnell of WPVI, Channel 6 has kindly agreed to "wheel and deal" if time permits. Tickets are $50.00 each. Please call the following numbers for tickets: 610-872-3427 or 610-565-5928 We hope that you'll join us for the fun This year is special, Alex is now a teenager. The key to Alex's well being is the vigilant care and the extraordinary love that is given to Alex by his medical staff, teachers, friends, family and most especially his parents. Although in his thirteen years Alex has experienced more setbacks than he would care to remember, he remains the sweet earthly angel that was sent to us to teach us all the true meaning of love. By supporting the Friends of Alexander Deihl your care and concern is lovingly demonstrated. With your contributions, we continue to purchase equipment such as ramps, wheelchair accessories, computers and adaptive bicycles to name a few. You have assisted children and their families with the prohibitive costs of prolonged hospital stays. Your help has lightened the burden of grieving families. On behalf of all of them we offer our deepest gratitude.

85. Syndrome, Menkes Definition - Medical Dictionary Definitions Of Popular Medical Online Medical Dictionary and glossary with medical definitions. http://www.medterms.com/script/main/art.asp?articlekey=16739

86. Menkes’ Disease, Menkes' Syndrome menkes’ disease is a rare hereditary disorder caused by a deficiency of copper.1 Untilrecently, menkes’ disease was considered universally fatal.2 However, http://www.truestarhealth.com/Notes/1237000.html

Weight Loss Truestar k i d s Encyclopedia of Health Natural Health Sport - Specific Training News Reel Online Store Hi ! Welcome to Truestar Health. Log In Welcome to the Truestar Health Encyclopedia Welcome to the Truestar Health Encyclopedia –the most comprehensive information database available on health, wellness, food, nutrition, vitamins and supplements. Use of our encyclopedia will enable you to make well-informed, responsible decisions for the promotion of your own health and wellness. Enter search items Also indexed as: Menkes' Syndrome Introduction Checklist Symptoms Treatments ... copper However, it now appears that the severity of the disease varies from person to person. Medical doctors often use genetic analysis to diagnose this disorder, even before birth. In cases where the genetic defect appears responsive to copper therapy, early treatment is needed to minimize the severity of the physical defects that will develop later. Rating Nutritional Supplements Herbs Copper (injectable) Reliable and relatively consistent scientific data showing a substantial health benefit.

87. Discovering Nutrition: Interactive Glossary Definition For 'Menkes' Syndrome' Interactive Glossary Definition. menkes syndrome A genetic disorder thatresults in copper deficiency. Search by term (please enter only one word or http://nutrition.jbpub.com/discovering/interactive_glossary_showterm.cfm?term=Me

88. Menkes' Syndrome menkes syndrome. Used for. kinky hair syndrome. Used for. steely hair syndrome.Broader Terms. cerebral degeneration. Broader Terms http://crisp.cit.nih.gov/Thesaurus/00004957.htm

Prev Term: meningomyelocele Next Term: Mennonite Menkes' syndrome Used for: kinky hair syndrome Used for: steely hair syndrome Broader Terms: cerebral degeneration Broader Terms: inborn metal metabolism disorder Broader Terms: syndrome Related Terms: sex linked trait Scope Note: X-linked recessive abnormality in copper absorption marked by severe cerebral degeneration and arterial changes resulting in death in infancy and by sparse, brittle scalp hair. Term Number: Send your comments to: Melody Lowe

89. Arch Dermatol -- Abstract: Metallothionein Gene Regulation In Menkes' Syndrome, Metallothionein gene regulation in menkes syndrome. DH Hamer Laboratory ofBiochemistry, National Cancer Institute, Bethesda, Md 20892. http://archderm.ama-assn.org/cgi/content/abstract/123/10/1384a

Select Journal or Resource JAMA Archives of Dermatology Facial Plastic Surgery Family Medicine (1992-2000) General Psychiatry Internal Medicine Neurology Ophthalmology Surgery Student JAMA (1998-2004) JAMA CareerNet For The Media Meetings Peer Review Congress Vol. 123 No. 10, October 1987 Featured Link E-mail Alerts ARTICLE Article Options Send to a Friend Readers Reply Submit a reply Similar articles in this journal Literature Track Add to File Drawer Download to Citation Manager PubMed citation Articles in PubMed by Hamer DH Contact me when this article is cited Metallothionein gene regulation in Menkes' syndrome D. H. Hamer Laboratory of Biochemistry, National Cancer Institute, Bethesda, Md 20892. The characteristic feature of Menkes' disease is a maldistribution of bodily copper; decreased copper levels are present in the serum, brain, and liver, whereas excess levels are present in gut, kidney, and most other nonhepatic tissues. Using cultured fibroblasts, we have shown that low extracellular copper concentrations induce synthesis of metallothionein, a copper-binding protein, in Menkes' cells but not in normal cells. This is

90. Role Of Metallothioneins In Copper Transport In Patients With Menkes Syndrome -- Fibroblasts from infants with menkes kinky hair syndrome, which accumulateexcessive quantities of copper, are thought to represent a disorder of copper http://www.annclinlabsci.org/cgi/content/abstract/8/4/302

HOME HELP FEEDBACK SUBSCRIPTIONS ... TABLE OF CONTENTS QUICK SEARCH: [advanced] Author: Keyword(s): Year: Vol: Page: This Article Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Alert me to new issues of the journal Download to citation manager PubMed Articles by Garnica, A. Articles by Rennert, O. Annals of Clinical and Laboratory Science, Vol 8, Issue 4, 302-309 Articles Role of metallothioneins in copper transport in patients with Menkes syndrome AD Garnica, WY Chan, and OM Rennert Fibroblasts from infants with Menkes kinky hair syndrome, which accumulate excessive quantities of copper, are thought to represent a disorder of copper storage or transport. Because of this abnormality, it was thought that they might provide a useful system for investigation of the presumed storage or transport protein metallothionein. Data are presented which are consistent with defective copper efflux from the mutant cells. Because of the more specific role of metallothionein in cadmium detoxification, studies of cadmium metabolism were undertaken which demonstrated abnormal cadmium retention and metallothionein induction in the mutant cells. The association, therefore, of a defect of cadmium metabolism and storage with an abnormality of copper efflux provides evidence implicating metallothionein in copper transport for fibroblasts. HOME HELP FEEDBACK SUBSCRIPTIONS ... TABLE OF CONTENTS

91. Menkes Kinky-hair Syndrome a CHORUS notecard document about menkes kinkyhair syndrome. http://chorus.rad.mcw.edu/doc/00262.html

CHORUS Collaborative Hypertext of Radiology Musculoskeletal system About CHORUS Search Feedback Menkes kinky-hair syndrome defective intestinal copper absorption X-linked recessive males only presents in early infancy Wormian bones Charles E. Kahn, Jr., MD - 2 February 1995 Last updated 26 May 2004 Related CHORUS documents: Wormian bones progeria (Hutchinson-Gilford) syndrome pyknodysostosis cleidocranial dysostosis ... cystic lymphangioma Search for related articles: AJR American Journal of Roentgenology PubMed : index to biomedical literature ... Medical College of Wisconsin

92. Menkes Kinky-hair Syndrome menkes kinkyhair syndrome. defective intestinal copper absorption. X-linkedrecessive; males only; presents in early infancy. Wormian bones http://chorus.rad.mcw.edu/to-go/00262.html

Menkes kinky-hair syndrome defective intestinal copper absorption X-linked recessive males only presents in early infancy Wormian bones Home Musculoskeletal system

93. Biochem. J. (1980) 192, 579-586 - Royce PM And Others - Reduced Lysyl Oxidase Ac oxidase activity in skin fibroblasts from patients with menkes syndrome. derived from a foetus with menkes syndrome, was 42% of that in the medium http://www.biochemj.org/bj/192/bj1920579.htm

About the journal Subscriptions Authors Users ... Download to Citation Matcher Biochem. J. (1980) Reduced lysyl oxidase activity in skin fibroblasts from patients with Menkes' syndrome. Royce PM, Camakaris J, Danks DM Immediate publications Current issue Advance contents (391 Pt.1) Browse archive ... Meetings and awards Full text options Email this article to a friend

94. RedNova News - Health - CLINICAL REVIEW: Disorders Of Copper Metabolism menkes syndrome is an inherited Xlinked copper deficiency disease. * Wilson sdisease results in excess copper in the liver, brain, and elsewhere. http://www.rednova.com/news/health/148409/clinical_review_disorders_of_copper_me

ANDP("ntn"); Ads_kid=0;Ads_bid=0;Ads_xl=0;Ads_yl=0;Ads_xp='';Ads_yp='';Ads_xp1='';Ads_yp1='';Ads_opt=0;Ads_wrd='[KeyWord]';Ads_prf='';Ads_par='';Ads_cnturl='';Ads_sec=0;Ads_channels=''; Home News Video Images ... Site Map SPECIAL NEWS Return to Flight REDNOVA NEWS Space Science Technology Health ... Video News REDNOVA EXTRAS RedNova E-Mail My RedNova Join RedNova RSS Feeds ... Tell A Friend, Win $500 Ads by Google Posted on: Friday, 6 May 2005, 03:00 CDT E-mail this to a friend Printable version Discuss this story in the forum Change Font Size: A A A CLINICAL REVIEW: Disorders of Copper Metabolism The essentials * Copper is an essential component of many enzymes. * Absorption of dietary copper mainly takes place in the small intestine. * Menkes' syndrome is an inherited X-linked copper deficiency disease. * Wilson's disease results in excess copper in the liver, brain, and elsewhere. * The Institute of Food Research is studying copper regulation and absorption. 1. The need for dietary copper The fact that copper is an essential element in the human diet is now well-established, but this has not always been the case. In the early 19th century the finding of copper in plant and animal tissues was thought to be due to contamination, either from the environment or in the sampling process. It wasn't until 1928 that the pioneering work of Hart and his colleagues demonstrated that both copper and iron were necessary for haemoglobin synthesis and the prevention of anaemia. An essential component Since then copper has been identified as an essential component of many enzymes, including those involved in antioxidant defence, connective tissue formation and neurological function. Despite its essential nature, copper levels need to be tightly regulated to avoid cellular excess and prevent its participation in reactions that produce oxygen-free radicals.This is important because free radical damage is thought to contribute to the development of cancer and cardiovascular disease.

95. Menkes, Syndrome De Translate this page Base de données sur les maladies rares et les médicaments orphelins. http://www.orpha.net/static/FR/menkes.html

Accès à la base de données Orphanet Menkes, syndrome de Accès direct aux détails Résumé Texte(s) long(s) http://www.orpha.net/data/patho/FR/fr-menkes.html Signes de la maladie CHEVEUX DEPIGMENTES/ALBINISME CHEVEUX RARES/HYPOTRICHIE/ATRICHIE CONVULSIONS EPILEPSIE DIFFICULTE D'ELEVAGE PILI TORTI REGRESSION PSYCHIQUE / DEMENCE TRANSMISSION RECESSIVE LIEE A L'X FACE FIGEE HYPERTONIE/RIGIDITE/SPASTICITE METAPHYSES ANOMALIE OS WORMIENS PEAU EPAISSE TROUBLES DU COMPORTEMENT Mise à jour : 04/09/2005 Accès à la base de données Orphanet

96. Anaesthetic Considerations In The Child With Menkes' Syndrome -- Tobias 39 (7): Anaesthetic considerations in the child with menkes syndrome menkes syndromeis an Xlinked recessive disorder of copper absorption and metabolism. http://www.cja-jca.org/cgi/content/abstract/39/7/712

HOME HELP FEEDBACK SUBSCRIPTIONS ... TABLE OF CONTENTS This Article Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager ... Cited by other online articles PubMed PubMed Citation Articles by Tobias, J. D. ARTICLES Anaesthetic considerations in the child with Menkes' syndrome JD Tobias Division of Pediatric Anesthesiology/Critical Care Medicine, Vanderbilt University, Nashville, Tennessee. The author presents and discusses the anaesthetic implications of a four-month-old infant with Menkes' syndrome who required tracheostomy. Menkes' syndrome is an X-linked recessive disorder of copper absorption and metabolism. Defective processing of copper results in abnormalities of several enzyme systems leading to severe dysfunction of multiple organ systems. Due to the progressive nature of this disorder and its severe effects on several different organ systems, most importantly the central

97. Blogcritics.org: "The Angry Puppet Syndrome" - By John Menkes Blogcritics menkes is a pediatric neurologist at UCLA, famous for his discoveryof Maple Syrup Urine Disease (you can guess the http://blogcritics.org/archives/2003/12/27/145225.php

Blogcritics recommends Cyberwurx Hosting with blog hosting as low as $5/month Jump to: main content Blogcritics Home A sinister cabal of superior bloggers on music, books, film, popular culture, technology, and politics. Search SPOTLIGHT ON: *HURRICANE KATRINA and AFTERMATH* ROBERTS and the CHANGING SUPREME COURT PRISON BREAK THE DUKE IN DUBLIN ... HARRY POTTER BLOGCRITIC OF THE DAY Visit and Pay Homage: JAMES D. CARMINE Are you a blogger? JOIN BLOGCRITICS SAVE TIME AND MONEY! Blogcritics is your BUYER'S GUIDE Follow the AMAZON links! Buy Now! Top Posters Most prolific Blogcritics for August Chris Beaumont Eric Olsen gypsyman Matt Paprocki ... Show your love: Link to Blogcritics! var site="s11blogcritics" Home "The Angry Puppet Syndrome" - by John Menkes Posted by bookofjoe on December 27, 2003 02:52 PM (See all posts by bookofjoe Filed under: Books Scroll down to read comments on this story and/or add one of your own. The Angry Puppet Syndrome John H. Menkes Book from Demos Medical Publishing Release date: 01 September, 1999 Menkes is a pediatric neurologist at UCLA, famous for his discovery of Maple Syrup Urine Disease (you can guess the main sign), also known as Menkes' Disease or Menkes' Syndrome. I was in his clinic one afternoon during my peds rotation at UCLA Med School, where some kid whose disease was undiagnosable was brought in. Menkes walked into the room with all of us med students, interns, and residents behind him, looked at the kid, asked the mother a few questions, wiggled the kid's finger and wrists, said, "this is a case of so-and-so," and walked out of the room.

98. Bladder Diverticula And Menkes' Syndrome -- Harcke Et Al. 124 (2): 459 -- Radiol Bladder diverticula and menkes syndrome. HT Harcke Jr, MA Capitanio, WD Groverand M ValdesDapena. Multiple unusual diverticula of the bladder were http://radiology.rsnajnls.org/cgi/content/abstract/124/2/459

HOME HELP FEEDBACK SUBSCRIPTIONS ... TABLE OF CONTENTS QUICK SEARCH: [advanced] Author: Keyword(s): Year: Vol: Page: This Article Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal ... Download to citation manager PubMed PubMed Citation Articles by Harcke, H. T., Jr Articles by Valdes-Dapena, M. ARTICLES Bladder diverticula and Menkes' syndrome HT Harcke Jr, MA Capitanio, WD Grover and M Valdes-Dapena Multiple unusual diverticula of the bladder were observed in 3 of 4 children with Menkes' syndrome. This abnormality of the bladder in children with the kiky hair syndrome has only recently been recognized. The diverticula are best visualized on cystographic studies. The clinical manifestation which led to roentgen evaluation of the urinary tract in the 3 children was urinary tract infection or urine retention. Though the

99. Menkes's Syndrome. Report Of A Patient Treated From 21 Days Of Age With Parenter In an infant with menkes s steelyhair syndrome, early treatment (from 21 daysof age) with parenteral copper failed to halt the disease. http://adc.bmjjournals.com/cgi/content/abstract/archdischild;53/12/956

HOME HELP FEEDBACK SUBSCRIPTIONS ... TABLE OF CONTENTS Author Keyword(s) Vol Page [Advanced] This Article Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Services Email this link to a friend Similar articles in ADC Online Similar articles in PubMed Alert me to new issues of the journal ... Download to citation manager PubMed PubMed Citation Articles by Daish, P Articles by Jones, R. PAPERS Menkes's syndrome. Report of a patient treated from 21 days of age with parenteral copper P Daish, EM Wheeler, PF Roberts and RD Jones In an infant with Menkes's steely-hair syndrome, early treatment (from 21 days of age) with parenteral copper failed to halt the disease. In addition to urinary tract abnormalities, panlobular emphysema was present a finding not previously noted in the syndrome.

100. Copper, Serum Or Plasma Deficiency, Nutritional, menkes syndrome, Acute Copper Toxicity, ICC and ChronicCopper Toxicity, Wilson s Disease, Smoking, Inflammatory Conditions, http://www.labcorp.com/datasets/labcorp/html/chapter/mono/bm004700.htm

Copper, Serum or Plasma Number CPT Related Information Copper, Urine Synonyms Cu, Plasma; Cu, Serum Specimen Serum or plasma Volume 1 mL Minimum Volume 0.2 mL Container Red-stopper tube or royal blue-stopper (EDTA or heparinized plasma) tube Collection Serum must be separated from cells within 45 minutes of collection and transferred to a plastic transport tube. Plasma may be separated immediately and transferred to a plastic transport tube for shipment to the laboratory. Storage Instructions Maintain specimen at room temperature. Causes for Rejection Gel tube; unspun red-stopper tube Reference Interval Use Serum copper is low in Menkes' syndrome. Copper in the CSF is reported to mirror the neurotoxicity of copper in Wilson disease. Liver copper is used to confirm Wilson disease and Menkes' syndrome and may be measured in liver disease of uncertain etiology. It can confirm ICC in the right setting. Liver copper rises with time in biliary cirrhosis, but does not confirm the diagnosis. Copper, Serum or Plasma Deficiency, Nutritional Menkes' Syndrome Acute Copper Toxicity ICC and Chronic Copper Toxicity Wilson's Disease Smoking, Inflammatory Conditions, Pregnancy, Estrogens

A  B  C  D  E  F  G  H  I  J  K  L  M  N  O  P  Q  R  S  T  U  V  W  X  Y  Z

Page 5     81-100 of 106    Back | 1  | 2  | 3  | 4  | 5  | 6  | Next 20